Pseudoexfoliation Glaucoma Risk Assessment Through Genetic Screening

Aurinjoy Gupta1, Heidi Forsyth1, Daenis Camire1, Thomas Cousineau2, Neelam Khaper*1, Sanjoy K. Gupta*1

1Northern Ontario School of Medicine, Lakehead University, Thunder Bay, Ontario, Canada.

2Cousineau Health Services Inc., Fort Frances, Ontario, Canada.

*Corresponding Authors:

1) Sanjoy K. Gupta sgupta@tbaytel.net

1) Neelam Khaper nkhaper@nosm.ca

Received: April 15, 2019; Accepted: May 7, 2019; Published: May30, 2019

Abstract

Background: Pseudoexfoliation syndrome (PEXS) is an inherited form of glaucoma common in people of Scandinavian and British origin. It may affect 10-20% of people over the age of 60 years, and if uncontrolled may lead to blindness. Characteristic DNA sequence changes (polymorphisms) in the LOXL1 gene are associated with PEXS. A characteristic polymorphism pattern (the G-G haplotype) has a high rate of association with PEXS in the Icelandic population. We hypothesized that the transmission of the G-G haplotype from parent to child may be used to diagnose PEXS in the children in the absence of clinical disease.

Methods: Thirty-three Northern Ontario patients of Scandinavian or British origin with Pseudoexfoliation glaucoma (PEXG) or syndrome (PEXS), and their children were recruited. Patients and age-matched controls were tested for the presence of high-risk G-G haplotype in the LOXL1 gene. Next, children were tested for the presence or absence of the high-risk haplotype.

Results: The G-G haplotype had an extremely high association with PEX (odds ratio of 27.7) in the patient population. Therefore, the G-G haplotype is associated with a high risk of having PEX.  Furthermore, 29/32 children of the PEX patients could be categorized based on the presence or absence of the inherited G-G haplotype (predicting high risk of having PEX) with a diagnostic yield of 91%.

Interpretation: Patients with known PEXS may be screened for the characteristic high-risk G-G haplotype. Their adult children who are found to have positive G-G haplotype have a high risk to progress to PEXG. For the first time, we may be able to screen and identify at-risk adult children of patients with PEXG and offer pre-emptive treatment before the clinical symptoms of PEXG are apparent. 

Keywords: Pseudoexfoliation glaucoma; LOXL1 gene; genetic screening and risk assessment.

Abbreviations (in alphabetical order):

CAD Canadian dollars
G153D Mutation in LOXL1 protein, Glycine 153 to Aspartate 153
IOP Intraocular pressure
LOXL1 Lysyl oxidase-like 1 gene
NOAMA Northern Ontario Academic Medicine Association
NOSM Northern Ontario School of Medicine
PCR Polymerase Chain Reaction
PEX Pseudoexfoliation (syndrome and glaucoma)
PEXS Pseudoexfoliation syndrome
PEXG Pseudoexfoliation glaucoma
QALY Quality-adjusted life years
R141L Mutation in LOXL1 protein, Arginine 151 to Leucine 151
SNP Single nucleotide polymorphism

Introduction

Pseudoexfoliation syndrome (PEXS), a genetically inherited risk of glaucoma, has been estimated to affect 10 – 20 % of the general population aged 60 years of age or more [1]. PEXS is easily recognized by the abnormal formation of fibrillar material deposits on the lens capsule.

These deposits accumulate in the trabecular meshwork (tissue located around the base of the cornea) and can block the normal drainage of fluids, which leads to increased intraocular eye pressure (IOP). PEXS can progress into Pseudoexfoliation glaucoma (PEXG), an inherited autosomal dominant form of glaucoma that is aggressive and results in rapid damage to the optic nerve [2-4]. The risk of progression from PEXS to PEXG increases to 60% over 15 years [5].

The lysyl oxidase-like 1 (LOXL1) gene is involved in the PEX pathophysiology [6-8]. The LOXL1 gene encodes an isoform of the enzyme lysyl oxidase, which is involved in the linking of tropoelastin molecules, which form mature elastin connective tissue [9].

Two single nucleotide polymorphisms (SNPs) that lead to mutations in the coding region of LOXL1 have been strongly associated with PEXS and PEXG [5].  These two polymorphisms, located within the first exon of LOXL1, are c.422G>T; (p.Arg141Leu, rs1048661) and the second, c.458G>A; (p.Gly153Asp, rs3825942). Thorleifsson first reported a substantial risk of PEXS with the presence of both polymorphisms in the native population of Iceland [5].

A recent meta-analysis of 21 independent cohorts of Caucasian populations has further substantiated that the presence of both mutations (Arg141Leu and Gly153Asp) and the G-G haplotype are risks for PEXS in Caucasians [8].

Early detection of glaucoma allows for pre-emptive treatments such as prescription drops, or laser eye surgery that can stabilize the condition [10,11]. Since at least 50 % of the optical nerve fibres may be lost by the time visual field impairment is detected, the use of genetic screening would be of great use for those with a family history of glaucoma [10-12].

Our strategy involved the clinical and genetic assessment of the affected parents (Figure 1). We first identified the risk alleles in the Caucasian patients who were of Western European descent. Through genetic screening for high-risk alleles, we identified adult children of patients with PEXG with a high risk of developing PEXG.

This would allow them to seek pre-emptive treatment for this ‘silent’ sight-threatening condition.

                                  A                                                                                                                         B

Strategies To Assess Genetic Risk In Children Of Patients With Pseudoexfoliation Glaucoma Or Syndrome.
Figure A & B: Strategies To Assess Genetic Risk In Children Of Patients With Pseudoexfoliation Glaucoma Or Syndrome.

We recruited patients of Scandinavian and Celtic origin from Northern Ontario and tested the presence of R141L and G153D polymorphisms. Children of these patients were then tested for the presence of these genetic changes, and thereby assessed for risk to acquire Pseudoexfoliation.

Methods

Patients and controls were of Caucasian origin (self-declared) with ancestry from Western Europe (specifically the U.K, Sweden, Norway and Finland).Clinical recruitment: Ethics approval was obtained prior to the commencement of the study from the Lakehead University Research Ethics Board.  Patients with PEXG or PEXS and age- and gender-matched controls were recruited from private ophthalmic and optometric practices in Northern Ontario, Canada (SKG, Thunder Bay and TC, Fort Frances, respectively).

Complete eye exams were carried out for both patients and controls. Patients were only included if they exhibited the presence of Pseudoexfoliation deposits in the anterior lens capsule, pupil margin, corneal endothelium and angle.  Patients were categorized as PEXG if they also had at least two out of the following three findings: IOPs recorded greater than 21 mm Hg, characteristic optic nerve damage (cup to disc ratios greater than 0.4 in either eye, thin or notched neuroretinal rim, disc hemorrhage), and corresponding changes in the visual field.  Patients were categorized as PEXS if they had the presence of pseudoexfoliative material, but normal IOP <21 mm Hg in both eyes, and normal cup to disc ratios.

Control Caucasian subjects (approximately two age-matched and gender-matched per patient) were recruited from ophthalmic practice (SKG) undergoing cataract surgery or treatment for retinal conditions (exudative age-related macular degeneration, diabetic retinopathy, central or branch retinal vein occlusions).  Once patients with PEXG and PEXS were recruited, their children were invited to participate in the study.

DNA collection and extraction: Saliva (2 mL) was collected from patients using Oragene DNA Self-Collection kits (DNA Genotek, Kanata, ON, Canada) following informed consent. DNA was extracted from a 500 µL aliquot of the collected saliva and purified using Prep-IT L2P (DNA Genotek, Kanata, ON, Canada) following the manufacturer’s instructions. The concentration and purity of the DNA was quantified using absorbance readings from a Take3 micro-volume plate and Gen5 software (BioTek, Winooski, VT, USA). DNA concentration (adjusted to 50 ng/µL based on the Take3 results) was stored at 4 °C until needed for further analysis.

PCR Amplification of the LOXL1 exon 1

Polymorphisms: The LOXL1 gene exon 1 polymorphisms were amplified using primers as described previously and described in Table I [13]. The final concentration of each PCR component in a 50 µL reaction were as follows: 0.025 units/µL Taq DNA polymerase (New England Bio Labs, Ipswich, MA, USA), 200 µM dNTPs, 1X standard Taq reaction buffer (New England Bio Labs), 1 µM of forward and reverse primers and 10% dimethyl sulfoxide (DMSO).

The PCR cycling times and temperatures were as follows: 1 cycle at 95 °C for 2 minutes, 30 cycles of (95 °C for 30 seconds, 60 °C for 30 seconds, 68 °C for 45 seconds) and a final cycle of 68 °C for 5 minutes.

SNP LOCATION OF SNP 5’ PRIMER SEQUENCE 3’ PRIMER SEQUENCE FRAGMENT SIZE (bp)

(RESTRICTION ENZYME)

rs16958477 Promoter TGCACCTGGGACCTGGAATTAGAGA CTGAGGAAGGGAATCGAGCAGGG 416

(BanI)

rs1048661 Exon 1 GCAGGTGTACAGCTTCTCA ACACGAAACCCTGGTCGTAG 464

(ApaI)

rs3825942 Exon 1 GCAGGTGTACAGCTTCTCA ACACGAAACCCTGGTCGTAG 464

(HinfI)

rs2165241 Intron 1 TAGGGCCCCTTGGAGAATAG GTCCCATTCCCCTCTCAATC 264

(SspI)

TABLE I: Primer Sequences and Restriction Enzymes used to screen LOXL1 Polymorphisms

PCR Amplification of the LOXL1 promoter and intron 1 polymorphisms: The LOXL1 gene promoter polymorphism (rs19658477) and intron 1 polymorphism (rs 2165241) were amplified by PCR using primers as described in Table I [13, 14].  The final concentration of each PCR component in a 50-µL reaction were as described above, however DMSO was not added to the reaction mixtures.

The PCR cycling times and temperatures were as follows: 1 cycle at 95 °C for 2 minutes, 30 cycles of (95°C for 30 seconds, 60 °C for 30 seconds, 68 °C for 45 seconds) and a final cycle of 68 °C for 5 minutes.

Restriction enzyme digestion and gel electrophoresis for SNPs: PCR product (10 µL) was digested using the appropriate restriction enzymes, as listed in Table I, according to the manufacturer’s protocol (Fisher Scientific, Ottawa, ON, Canada) in a total volume of 40µL.

Restriction digests were carried out for a period of 1 hour at 37°C, except for BauI restriction digests that were carried out for 16 hours at 37°C.  After the digestion, 20 µL of the sample was loaded onto a 3% agarose gel. The gel was electrophoresed at 100 V for 50 minutes.

The bands were visualized using SYBRsafe (Fisher Scientific, Ottawa, ON, Canada) staining and UV transillumination on a Chemidoc XRS gel Imaging station with Quantity One software (Bio-Rad Laboratories, Mississauga, ON, Canada).

Statistical Analysis: The data was analyzed using Microsoft Excel Software. The Hardy-Weinberg equilibrium and the significance between the allele and genotype frequencies were assessed using a standard chi-square test.  Odds ratios for the allele and genotype frequencies of the PEX patient compared to the non-PEX control group were also calculated.

A p-value of <0.05 was considered statistically significant. An estimation of the odds ratios when one of the elements of the 2×2 matrix is zero was carried out with the process described by Valenzuela [15].

Results

Many patients required trabeculectomies to control the progression of the disease; some required Ahmed valve insertion (e.g. P8) or multiple surgical procedures (e.g. P9) and topical hypotensive agents to achieve target intraocular pressure.We recruited 33 patients and 52 control patients of Caucasian origin for this study from two cities (Thunder Bay and Fort Frances) in Northern Ontario, Canada.  Patients were of British, Swedish, Norwegian and Finnish ancestry. The clinical characteristics of 20 selected patients are depicted in Table II, and show typical features of PEXG and PEXS.

This exemplifies the aggressiveness of PEXG. Thirty-two children of the aforementioned 20 patients eventually participated in the study. 

PATIENT No AGE/

GENDER

PEXS/PEXG BCVA C/D RATIO IOP ON LAST EXAM NUMBER OF

GLAUCOMA

MEDICATIONS

SURGICAL INTERVENTIONS/

OTHER OCULAR CONDITIONS

P3 77F PEXS 1/0.2 0.6/0.6 13/11 0 CE/IOL/OU

PROLIF. DIABETIC RETINOPATHY

P4 69F PEXS 0.1/0.1 0.4/0.5 16/15 0
P5 77F PEXG 0.1/0.1 0.3/0.1 14/14 0 CE/IOL/TRAB/OU
P6 81F PEXS 0.1/0.1 0.7/0.6 18/18 0 CE/IOL/OD
P7 86F PEXG 0.2/0.3 0.5/0.4 13/15 3 SUBLUXED IOL, OS

CE/IOL/TRAB,OD

P8 67M PEXG 0.2/0.2 0.5/0.9 12/11 2 TRAB, OS; SLT, OU

AHMED VALVE, OU

P9 88F PEXG 0.4/0.4 0.4/0.7 18/9 2 CE/IOL/OU

TRAB, OS X 2

P10 84F PEXG 0.6/0.6 0.6/0.5 14/15 1 CE/IOL/OU

ARMD, OU

P12 78F PEXS 0/0.5 0.1/0.1 13/15 1 CE/IOL/OU
P15 79F PEXS 0.2/0.1 0.1/0.1 15/15 0 CE/IOL/OU

ARMD, OU

P16 77F PEXS 0/0 0.3/0.3 10/11 0 ARMD, OU
P17 71F PEXG 0/0 0.6/0.6 18/20 2 NPDR
P18 86F PEXG 0.2/0.1 0.8/0.6 34/12 4 CE/IOL/TRAB/OD
P19 75F PEXG 0/0 0.6/0.6 17/19 0 CE/IOL/TRAB/OU
P21 82M PEXG 0.5/0.2 0.9/0.8 14/9 3 CE/IOL/TRAB/OU
P23 73F PEXG 0/0 0.6/0.5 12/10 0 CE/IOL/TRAB/OU
P24 96F PEXG -/0.1 -/0.5 -/11 2 CE/IOL/OSEVISCERATION, OD
P26 84F PEXS 0/0 0.6/0.6 16/13 0 CE/IOL/OU
P27 76F PEXS 0/0 0.2/0.2 15/20 0 0
P32 79F PEXG 0.3/0.1 0.7/0.4 18/20 2 CE/IOL/OS

TABLE II: Clinical Characteristics of Select Patients

We determined the allele and haplotype frequencies of the LOXL1 polymorphisms, R141L (T->G) and G153D (A->G) in both patients and controls.  The results are shown in Table III.  The allele frequencies of the SNPs were significantly different when comparing cases and controls, and were associated with PEX, increasing disease susceptibility from 1.3-fold (R141L) to 16.4 fold (G153D).

SNP ID   PEX % (n=33) Control% (n=52) p value OR (95% CI)
R141L rs1048661
Allele G 72.7 67.3 0.45 1.30 (0.57-2.21)
  T 27.3 32.7 0.77 (0.45-1.76)
Genotype GG 45.4 46.2 0.11 0.97 (0.41-2.37)
  GT 54.5 42.3 1.64 (0.51-2.98)
  TT 0 11.5 0.11 (0.04-3.22)
 
G153D

rs3825942

Allele G 100.0 89.4 0.006 16.36 (0.43-26.5)
  A 0 10.6 0.06 (0.04-2.34)
Genotype GG 100.0 82.7 0.041 14.63(0.39-26.29)
  GA 0 13.5 0.09 (0.04-2.95)
  AA 0 3.8 0.30 (0.06-5.95)

TABLE III. Allele and Genotype Frequencies of R141L and G153D SNPs in PEX Patients and Controls

The G allele of rs1048661 (leading to R141L) showed mild association with PEX though not statistically significant (p=0.45; OR=1.3; 95%CI: 0.57-2.21). Also, the GG and GT genotype at rs1048661 showed mild association with PEX (OR ranging from 0.97-1.64) while the TT genotype was completely absent in PEX patients.  There was a strong polarization of alleles at rs3825942 in PEX patients versus controls.

The G allele of SNP rs3825942 (leading to G153D) was detected in 100% in PEX patients. Therefore, the association of the G allele of rs3825942 showed extremely strong association with PEX (p=0.006; OR=16.4, 95%CI: 0.43-26.5). These allele frequencies are consistent with data from other studies with Caucasian patients.  The observed genotype frequencies of the two LOXL1 SNPs were found to be in Hardy-Weinberg equilibrium for both PEX patients and controls (data not shown).

As each G allele at the above SNPs showed association with PEX, we expected that the combination of these two alleles or the G-G haplotype would also show strong association to PEX.

We examined the association of the G-G haplotype with PEX and control patients.  The results are shown in Table IV.  The G-G and G-T haplotypes showed association with PEX (OR ranging from 1.63-1.67), while G-A and T-A haplotypes were completely absent in PEX patients.  The polarization of alleles at these two loci resulted in very high genotype combinations.  The combination of GG/GT genotype at R141L and GG genotype at G153D had an extremely high association with PEX, leading to an odds ratio of 27.7.

HAPLOTYPE

R141L/G153D

  p value OR (95% CI)
 
GG 0.18 1.63 (0.60-2.53)
GA 0.01 0.08 (0.04-2.63)
TG 0.20 1.67 (0.57-2.73)
TA 0.26 0.32 (0.06-5.99)
 
GENOTYPE COMBINATIONS  

 

R141L G153D
GG/GT GG p<0.001 27.7 (0.53-33.62)
GG/GT GA/AA 0.01 0.07 (0.04-2.56)
TT GG 0.04 0.11 (0.04-3.22)
TT GA/AA p>0.5 1.57 (0.07-20.1)

TABLE IV: Haplotype Frequencies of R141L/ G153D SNPs in PEX Patients and Controls

We then examined the presence of the SNPs in 32 children of the patients with an aim to develop an assessment of risk of developing PEX.  The allele frequencies of the SNPs were determined for the children as a group, as well as the frequency of the G-G haplotype.

There were a high number of children who had the G risk alleles at the two SNPs as well as the G-G haplotype.  Using the haplotype analysis 24/32 children were determined to have PEX risk, 6/32 children were not at risk and three children were found to be of an indeterminate risk.

This indicates that a critical number of children are at risk to develop PEX.  On a case-by-case basis, 29 /32 children of the PEX patients could be categorized based on the presence or absence of the inherited G-G haplotype (Table V) with a diagnostic yield of 91%.

Patient No Age/

Gender

PEXS/PEXG HAP CHILD 1

HAP

RISK

STATUS

CHILD 2

HAP

RISK

STATUS

CHILD 3

HAP

RISK

STATUS

P3 77F PEXS GT

GG

GG

GG

AT RISK GG

GG

AT RISK    
P4 69F PEXS GG

GG

GG

GG

AT RISK GG

GG

AT RISK    
P5 77F PEXG GG

GG

GT

GG

AT RISK GT

GG

AT RISK    
P6 81F PEXS GG

GG

GG

GG

AT RISK        
P7 86F PEXS GG

GG

GG

GG

AT RISK GG

GG

AT RISK    
P8 67M PEXG GT

GG

TT

GG

NOT AT RISK GT

GG

AT RISK    
P9 88F PEXG GG

GG

    GG

GG

AT RISK GT

GG

AT RISK
P10 84F PEXG GG

GG

GT

GG

AT RISK        
P12 78F PEXS GT

GG

GG

GG

AT RISK        
P15 79F   GG

GG

GG

GA

AT RISK GG

GG

AT RISK GG

GG

AT RISK
P16 77F PEXS GT

GG

TT

GG

NOT AT

RISK

TT

GG

NOT AT

RISK

GT

GG

AT RISK
P17 71F PEXG GT

GG

GG

GG

AT RISK        
P18 86F PEXG GT

GG

GT

GA

INDET*=>

NOT AT RISK

GG

GA

AT RISK GT

GG

INDET*
P19 75F PEXG GG

GG

GG

GG

AT RISK        
P21 82M PEXG GG

GG

GT

GA

AT RISK        
P23 73F PEXG GG

GG

GT

GG

AT RISK        
P24 96F PEXG GT

GG

GT
GA
INDET*        
P26 84F PEXS GG

GG

GG

GG

AT RISK        
P27 76F PEXS GT

GG

TT

GG

NOT AT

RISK

       
P32 79F PEXG GT

GG

TT

GG

NOT AT

RISK

       

TABLE V: Haplotypes of Patients and Children

Extended haplotype analysis was carried out using the gene promoter and intron 1 SNPs, in cases where the pattern of haplotype transmission could not be definitely determined from only the R141L and G153D polymorphisms.  Of the 3 indeterminate cases, one could be resolved using extended haplotype analysis (data not shown).  Thus, extended haplotype analysis increased the diagnostic yield of the test to 94% (30/32) of children tested.

Discussion

The present study addresses the question of genetic risk in children of parents with PEXG/PEXS.  A PEXG patient of Finnish background from Northern Ontario, who had gone blind in both eyes from late diagnosis of PEXG, inspired this study. The patient’s daughter had asked if there was a way using genetics to assess her own risk of acquiring PEXG. 

We have shown that a combined clinical and genetic screening strategy may be used to identify children of PEX patients who are at risk of progressing to PEX as well (Figure 2, top panel).  If we consider a simple dominant model of inheritance, the children would have a 50% risk of acquiring LOXL1 risk allele from the parent, and therefore a pre-test odds ratio of approximately 0.5 of progressing to PEX.

If we further assume that PEX has incomplete penetrance and a more complex etiology (presence of PEXS, where only 60% progress to PEXG; age-dependent development of PEXG), the calculated pre-test odds would drop to less than 0.5.  Using the genetic screening test for the G-G haplotype, we can increase the odds ratio of acquiring PEX in children to at least the same level observed for the parent/patient group, i.e. odds ratio = 1.63. The positive predictive value for this G-G haplotype test in the children’s group would therefore be (post-test odds ratio/pre-test odds ratio) equal to 3.26..

There is now ample evidence that LOXL1 mutations are associated with PEXG. The biochemical basis of the disease is not well understood at present.  A careful ethnicity-based meta-analysis of 21 independent cohorts showed the association of G haplotype in rs1048661 with disease in Caucasian patients; however, this risk was reversed in Black South Africans, Asian, and Chinese populations [8].

The increased risk of PEX with the G-G haplotype as described in our study is very consistent with other studies in Caucasian populations and in a meta-analysis study.  Moreover, our G-G haplotype test for children of affected patients extends this wealth of data to practical use in the clinic.

It is likely that other environmental/genetic factors modulate the effect of the LOXL1 gene product and subsequently the effect of LOXL1 gene mutations.  Hauser and co-workers have proposed that an antisense gene promoter exists within the first intron and first exon of LOXL1 creating a non-coding RNA (i.e., a non-coding transcript in the reverse direction as the LOXL1 gene) [16]. In their studies, they showed that the antisense promoter was upregulated in patients with all four LOXL1 risk alleles.

Moreover, promoter activity was enhanced with oxidative and mechanical stress in a cell culture model system.  Hauser and co-workers concluded that antisense non-coding RNA may modulate the LOXL1 biochemical pathway.  Moreover, such intragenic factors as well as extraneous factors may affect the level of mutant gene expression, and result in two different conditions, namely, PEXS and the actual disease form, PEXG.

Genetic screening has made great strides in the field of medicine and specifically in ophthalmology. Almost two decades ago, basic genetic screening strategies could be developed for specific families with inherited eye diseases such as aniridia, corneal dystrophies, specific retinal conditions or even syndromes with ocular manifestations [17-20].

The technology has sufficiently advanced to address disorders with multigenic etiologies such as Leber’s congenital amaurosis and Retinitis pigmentosa through whole-exome sequencing [21-24].  At the clinical level, the purpose of developing such screening tools would be to identify individuals at risk in the population and offer early or pre-emptive treatment.

In the current study, we used rapid genetic screening techniques to identify adult children of PEX patients as a group with high susceptibility for PEX.  Patients with known PEX may be screened for the two common PEX mutations.  Their adult children who are found to have positive PEX polymorphisms would have a high risk to progress to PEXG.

This study is pertinent to the population in Northern Ontario, as there is a relatively high incidence of PEX in our community [25].  For the first time, we may be able to screen and identify at-risk adult children of patients with PEX and possibly offer pre-emptive treatment. In a study of patients with unilateral PEXG, Yarangumeli and co-workers found 40% of the patients had glaucomatous damage in the ‘unaffected eye’ [26].

In a follow-up study from the same group, Koz and co-workers identified normotensive glaucoma in 25% of patients with PEXS [27]. Furthermore, this subset of PEXS patients were found to have higher mean IOP, higher maximum IOP and higher fluctuations (>4 mm Hg) in IOP.  PEXS/PEXG likely has preclinical manifestations that are often not recognised on clinical examination and routine testing.

Therefore, children of PEXG/PEXS patients who are at risk will likely benefit from genetic assessment and pre-emptive treatment during the preclinical phase (Figure 2, bottom panel).  Moreover, in countries with high incidence of PEX, it may be worthwhile screening for PEX risk using a similar approach, as the sensitivity of this detection method would be high due to a high carrier frequency.

The approach to population-based screening for PEX risk is analogous to screening for cystic fibrosis in Caucasian populations due to a high carrier frequency.

FIGURE 2:

SCHEMATIC DIAGRAM OF THE LOXL1 GENE AND POLYMORPHISMS

TOP: SCHEMATIC DIAGRAM OF THE LOXL1 GENE AND POLYMORPHISMS

The R141L and G153D single nucleotide polymorphisms present at the end of the first exon are indicated with the appropriate base polymorphisms.The G nucleotides leading the ‘G-G’ risk haplotype are shown in red.  The promoter polymorphism (rs19658477) and intron 1 polymorphism (rs2165241) are also indicated. 

BOTTOM: IMPACT OF GENETIC TESTING AND PRE-EMPTIVE TREATMENT FOR PSEUDOEXFOLIATION.

This diagram indicates the natural history of Pseudoexfoliation glaucoma, as well as the impact of genetic testing and pre-emptive treatment. Pseudoexfoliation is thought to cause insidious nerve-fiber layer loss (blue gradient) from an early onset (indicated by the blue triangle). Intraocular pressure rise from normal to abnormal levels (green to red gradient) and visual field changes may occur by the time the patient is diagnosed and treated for Pseudoexfoliation glaucoma (indicated by the red triangle). Genetic assessment of risk and pre-emptive treatment would save the patient from glaucomatous optic nerve damage.

Clinical Impact

Recent epidemiological studies have estimated the cost-effectiveness of interventions in glaucoma (screening and identifying glaucoma patients with tele-glaucoma; treating normal tension glaucoma) in terms of QALYs (quality-adjusted life years) and have estimated a $27,000 to $35,000 (CAD) per QALY over a 10-year period [28, 29].  The current screening program that we have proposed also identifies individuals at risk for progression to an aggressive form of glaucoma, and would be at least as cost-effective.  Given that this form of genetic screening is efficient and inexpensive (<$50/patient), this technology would be applicable and immediately transferrable worldwide, especially in the Scandinavian countries as well as the United Kingdom.

Acknowledgements/Financial Disclosure

The authors indicate no relationships/ conditions/ circumstances that present a potential financial conflict of interest.This study was supported by a grant from the Northern Ontario Academic Medicine Association (NOAMA). Aurinjoy Gupta and Heidi Forsyth contributed equally to this work.  Daenis Camire was supported by a Dean’s Summer Medical Student Research Award from the Northern Ontario School of Medicine (NOSM). We wish to thank Asia Loi, Judy Medwick, and Wendy Vester for their technical assistance.

References

  1. Schlötzer-Schrehardt U. “Molecular pathology of Pseudoexfoliation syndrome/glaucoma–new insights from LOXL1 gene associations”. Experimental eye research 88.4(2009):776-85.
  2. Ritch R and Schlötzer-Schrehardt U. “Exfoliation syndrome”. Survey of ophthalmology 45.4(2001):265-315.Schlötzer-Schrehardt U. “Molecular pathology of Pseudoexfoliation syndrome/glaucoma–new insights from LOXL1 gene associations”. Experimental eye research 88.4(2009):776-85.
  3. Finger JH. “Primary open-angle glaucoma genes”. Eye 25.5(2011):587-95.
  4. Schlötzer-Schrehardt U and Naumann GO. “Trabecular meshwork in Pseudoexfoliation syndrome with and without open-angle glaucoma. A morphometric, ultrastructural study”. Investigative ophthalmology & visual science.36.9 (1995):1750-64.
  5. Thorleifsson G, et al. “Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma”. Science.317.5843 (2007):1397-400.
  6. Fan BJ, et al. “DNA sequence variants in the LOXL1 gene are associated with Pseudoexfoliation glaucoma in a US clinic-based population with broad ethnic diversity”. BMC medical genetics.9.5.
  7. Mabuchi F, et al. “Lysyl oxidase-like 1 gene polymorphisms in Japanese patients with primary open angle glaucoma and exfoliation syndrome”. Molecular vision.14 (2008):1303-1308.
  8. Challa P, et al. “Analysis of LOXL1 polymorphisms in a United States population with Pseudoexfoliation glaucoma”. Molecular vision.14 (2008):146-149.
  9. Liu X, et al. “Elastic fiber homeostasis requires lysyl oxidase–like 1 protein”. Nature genetics.36.2 (2004):178-82.
  10. Founti P, et al. “Ethnicity‐Based Differences in the Association of LOXL1 Polymorphisms with Pseudoexfoliation/Pseudoexfoliative Glaucoma: A Meta‐Analysis”. Annals of human genetics.79.6 (2015):431-50.
  11. Adatia FA and Damji KF. Chronic open-angle glaucoma. Review for primary care physicians. Canadian family physician.51.9 (2005):1229-37.
  12. Quigley HA, et al. “Optic nerve damage in human glaucoma: III. Quantitative correlation of nerve fiber loss and visual field defect in glaucoma, ischemic neuropathy, papilledema, and toxic neuropathy”. Archives of ophthalmology.100.1 (1982):135-46.
  13. Chakrabarti S, et al. “The LOXL1 gene variations are not associated with primary open-angle and primary angle-closure glaucomas”. Investigative ophthalmology & visual science.49.6 (2008):2343-7.
  14. Álvarez L, et al. “LOXL1 gene variants and their association with Pseudoexfoliation glaucoma (XFG) in Spanish patients”. BMC medical genetics.16.1 (2015):1.
  15. Valenzuela C. “[2 solutions for estimating odds ratios with zeros]”. Revista medica de Chile. 121.12(1993):1441-4.
  16. Hauser MA, et al. “Genetic variants and cellular stressors associated with exfoliation syndrome modulate promoter activity of a lncRNA within the LOXL1 locus”. Human molecular genetics.24.22 (2015):6552-63.
  17. Gupta SK, et al. “Genotype/phenotype correlations in aniridia”. American journal of ophthalmology.126.2 (1998):203-10.
  18. Gupta SK, et al. “Lattice corneal dystrophy type 1 in a Canadian kindred is associated with the Arg 124→ Cys mutation in the kerato-epithelin gene”. American journal of ophthalmology.125.4 (1998):547-9.
  19. Gupta SK, et al. “A frame shift mutation in a tissue-specific alternatively spliced exon of collagen 2A1 in Wagner’s vitreoretinal degeneration. American journal of ophthalmology.133.2 (2002):203-10.
  20. Gupta S, et al. “Polymerase Chain Reaction–Based Risk Assessment for Wilms Tumor in Sporadic Aniridia”. American journal of ophthalmology.125.5 (1998):687-92.
  21. Wang X, et al. “Whole‐exome sequencing identifies ALMS1, IQCB1, CNGA3, and MYO7A mutations in patients with leber congenital amaurosis”. Human mutation.32.12 (2011):1450-9.
  22. Chen Y, et al. “Comprehensive Mutation Analysis by Whole-Exome Sequencing in 41 Chinese Families with Leber Congenital Amaurosis”. Investigative ophthalmology & visual science.54.6 (2013):4351-7.
  23. Züchner S, et al. “Whole-exome sequencing links a variant in DHDDS to retinitis pigmentosa”. The American journal of human genetics.88.2 (2011):201-6.
  24. Bowne SJ, et al. “A dominant mutation in RPE65 identified by whole-exome sequencing causes retinitis pigmentosa with choroidal involvement”. European journal of human genetics.19.10 (2011):1074-81.
  25. Brissette AR, et al. “Can you identify this condition? Pseudoexfoliation syndrome”. Canadian family physician.57.6 (2011): 683,687-688.
  26. Yarangümeli A, et al. “Glaucomatous damage in normotensive fellow eyes of patients with unilateral hypertensive Pseudoexfoliation glaucoma: normotensive Pseudoexfoliation glaucoma?”. Clinical & experimental ophthalmology.34.1 (2006):15-9.
  27. Koz OG, et al. “Normotensive glaucoma and risk factors in normotensive eyes with Pseudoexfoliation syndrome. Journal of glaucoma.18.9 (2009):684-8.
  28. Thomas S, et al. “The Cost-Effectiveness Analysis of Teleglaucoma Screening Device”. PloS one.10.9 (2015):e0137913.
  29. Li EY, et al. “Cost-Effectiveness of Treating Normal Tension Glaucoma Markov Decision-Analytic Health Model”. Investigative ophthalmology & visual science.54.5 (2013):3394-9.